ZN586.H12INVITRO.0.P.D motif - HOmo sapiens COmprehensive MOdel COllection

Motif	ZN586.H12INVITRO.0.P.D
Gene (human)	ZNF586 (GeneCards)
Gene synonyms (human)
Gene (mouse)
Gene synonyms (mouse)
LOGO
LOGO (reverse complement)
Motif subtype	0
Quality	D

Motif length	23
Consensus	GAGGCCTAGGAGGAAAAAATGGT
GC content	49.61%
Information content (bits; total / per base)	36.538 / 1.589
Data sources	ChIP-Seq
Aligned words	996

ChIP-Seq benchmarking	Num. of experiments (peaksets)	auROC, median	auROC, best	auPRC, median	auPRC, best	pseudo-auROC, median	pseudo-auROC, best	pseudo-log-auROC, median	pseudo-log-auROC, best	Centrality, median	Centrality, best
Human	1 (5)	0.978	0.996	0.982	0.996	0.978	0.997	18.998	19.497	902.602	972.276

TF superclass	Zinc-coordinating DNA-binding domains {2} (TFClass)
TF class	C2H2 zinc finger factors {2.3} (TFClass)
TF family	More than 3 adjacent zinc fingers {2.3.3} (TFClass)
TF subfamily	Unclassified {2.3.3.0} (TFClass)
TFClass ID	TFClass: 2.3.3.0.115
HGNC	HGNC:25949
MGI
EntrezGene (human)	GeneID:54807 (SSTAR profile)
EntrezGene (mouse)
UniProt ID (human)	ZN586_HUMAN
UniProt ID (mouse)
UniProt AC (human)	Q9NXT0 (TFClass)
UniProt AC (mouse)
GRECO-DB-TF	yes

ChIP-Seq	1 human, 0 mouse
HT-SELEX	0
Methyl-HT-SELEX	0

PCM	ZN586.H12INVITRO.0.P.D.pcm
PWM	ZN586.H12INVITRO.0.P.D.pwm
PFM	ZN586.H12INVITRO.0.P.D.pfm
Alignment	ZN586.H12INVITRO.0.P.D.words.tsv
Threshold to P-value map	ZN586.H12INVITRO.0.P.D.thr
Motif in other formats
JASPAR format	ZN586.H12INVITRO.0.P.D_jaspar_format.txt
MEME format	ZN586.H12INVITRO.0.P.D_meme_format.meme
Transfac format	ZN586.H12INVITRO.0.P.D_transfac_format.txt
Homer format	ZN586.H12INVITRO.0.P.D_homer_format_0.001.txt ZN586.H12INVITRO.0.P.D_homer_format_0.0005.txt ZN586.H12INVITRO.0.P.D_homer_format_0.0001.txt

PCM

	A	C	G	T
01	26.0	13.0	950.0	7.0
02	963.0	3.0	22.0	8.0
03	14.0	0.0	976.0	6.0
04	14.0	5.0	971.0	6.0
05	24.0	858.0	19.0	95.0
06	19.0	874.0	8.0	95.0
07	19.0	114.0	14.0	849.0
08	940.0	8.0	40.0	8.0
09	40.0	2.0	953.0	1.0
10	26.0	0.0	967.0	3.0
11	977.0	0.0	15.0	4.0
12	13.0	0.0	972.0	11.0
13	21.0	0.0	963.0	12.0
14	749.0	27.0	214.0	6.0
15	837.0	120.0	12.0	27.0
16	923.0	12.0	9.0	52.0
17	810.0	6.0	162.0	18.0
18	992.0	3.0	1.0	0.0
19	902.0	2.0	87.0	5.0
20	6.0	31.0	10.0	949.0
21	10.0	0.0	983.0	3.0
22	56.0	10.0	894.0	36.0
23	4.0	24.0	11.0	957.0

PFM

	A	C	G	T
01	0.026	0.013	0.954	0.007
02	0.967	0.003	0.022	0.008
03	0.014	0.0	0.98	0.006
04	0.014	0.005	0.975	0.006
05	0.024	0.861	0.019	0.095
06	0.019	0.878	0.008	0.095
07	0.019	0.114	0.014	0.852
08	0.944	0.008	0.04	0.008
09	0.04	0.002	0.957	0.001
10	0.026	0.0	0.971	0.003
11	0.981	0.0	0.015	0.004
12	0.013	0.0	0.976	0.011
13	0.021	0.0	0.967	0.012
14	0.752	0.027	0.215	0.006
15	0.84	0.12	0.012	0.027
16	0.927	0.012	0.009	0.052
17	0.813	0.006	0.163	0.018
18	0.996	0.003	0.001	0.0
19	0.906	0.002	0.087	0.005
20	0.006	0.031	0.01	0.953
21	0.01	0.0	0.987	0.003
22	0.056	0.01	0.898	0.036
23	0.004	0.024	0.011	0.961

PWM

	A	C	G	T
01	-2.202	-2.835	1.334	-3.358
02	1.347	-3.971	-2.358	-3.25
03	-2.769	-4.979	1.361	-3.48
04	-2.769	-3.618	1.356	-3.48
05	-2.277	1.232	-2.493	-0.952
06	-2.493	1.251	-3.25	-0.952
07	-2.493	-0.773	-2.769	1.222
08	1.323	-3.25	-1.793	-3.25
09	-1.793	-4.209	1.337	-4.522
10	-2.202	-4.979	1.352	-3.971
11	1.362	-4.979	-2.707	-3.779
12	-2.835	-4.979	1.357	-2.981
13	-2.401	-4.979	1.347	-2.905
14	1.097	-2.167	-0.15	-3.48
15	1.208	-0.723	-2.905	-2.167
16	1.305	-2.905	-3.152	-1.54
17	1.175	-3.48	-0.426	-2.542
18	1.377	-3.971	-4.522	-4.979
19	1.282	-4.209	-1.039	-3.618
20	-3.48	-2.036	-3.063	1.333
21	-3.063	-4.979	1.368	-3.971
22	-1.469	-3.063	1.273	-1.894
23	-3.779	-2.277	-2.981	1.341

Standard thresholds

P-value	Threshold
0.001	-11.87319
0.0005	-9.79869
0.0001	-5.33684