ZN550.H12INVIVO.0.P.C motif - HOmo sapiens COmprehensive MOdel COllection

Motif	ZN550.H12INVIVO.0.P.C
Gene (human)	ZNF550 (GeneCards)
Gene synonyms (human)
Gene (mouse)
Gene synonyms (mouse)
LOGO
LOGO (reverse complement)
Motif subtype	0
Quality	C

Motif length	31
Consensus	CTTCTGCACTGCCCTAGCAGAGGTTCTCCAT
GC content	53.52%
Information content (bits; total / per base)	50.73 / 1.636
Data sources	ChIP-Seq
Aligned words	61

ChIP-Seq benchmarking	Num. of experiments (peaksets)	auROC, median	auROC, best	auPRC, median	auPRC, best	pseudo-auROC, median	pseudo-auROC, best	pseudo-log-auROC, median	pseudo-log-auROC, best	Centrality, median	Centrality, best
Human	1 (2)	0.761	0.761	0.756	0.756	0.904	0.904	12.58	12.58	59.745	59.745

TF superclass	Zinc-coordinating DNA-binding domains {2} (TFClass)
TF class	C2H2 zinc finger factors {2.3} (TFClass)
TF family	More than 3 adjacent zinc fingers {2.3.3} (TFClass)
TF subfamily	Unclassified {2.3.3.0} (TFClass)
TFClass ID	TFClass: 2.3.3.0.71
HGNC	HGNC:28643
MGI
EntrezGene (human)	GeneID:162972 (SSTAR profile)
EntrezGene (mouse)
UniProt ID (human)	ZN550_HUMAN
UniProt ID (mouse)
UniProt AC (human)	Q7Z398 (TFClass)
UniProt AC (mouse)
GRECO-DB-TF	yes

ChIP-Seq	1 human, 0 mouse
HT-SELEX	0
Methyl-HT-SELEX	0

PCM	ZN550.H12INVIVO.0.P.C.pcm
PWM	ZN550.H12INVIVO.0.P.C.pwm
PFM	ZN550.H12INVIVO.0.P.C.pfm
Alignment	ZN550.H12INVIVO.0.P.C.words.tsv
Threshold to P-value map	ZN550.H12INVIVO.0.P.C.thr
Motif in other formats
JASPAR format	ZN550.H12INVIVO.0.P.C_jaspar_format.txt
MEME format	ZN550.H12INVIVO.0.P.C_meme_format.meme
Transfac format	ZN550.H12INVIVO.0.P.C_transfac_format.txt
Homer format	ZN550.H12INVIVO.0.P.C_homer_format_0.001.txt ZN550.H12INVIVO.0.P.C_homer_format_0.0005.txt ZN550.H12INVIVO.0.P.C_homer_format_0.0001.txt

PCM

	A	C	G	T
01	0.0	54.0	0.0	7.0
02	0.0	5.0	1.0	55.0
03	4.0	0.0	1.0	56.0
04	0.0	55.0	0.0	6.0
05	4.0	8.0	1.0	48.0
06	1.0	0.0	60.0	0.0
07	0.0	61.0	0.0	0.0
08	55.0	0.0	0.0	6.0
09	0.0	61.0	0.0	0.0
10	0.0	0.0	0.0	61.0
11	11.0	0.0	50.0	0.0
12	0.0	60.0	0.0	1.0
13	0.0	61.0	0.0	0.0
14	0.0	56.0	0.0	5.0
15	0.0	0.0	0.0	61.0
16	61.0	0.0	0.0	0.0
17	0.0	0.0	61.0	0.0
18	0.0	60.0	0.0	1.0
19	58.0	3.0	0.0	0.0
20	3.0	0.0	53.0	5.0
21	56.0	1.0	0.0	4.0
22	4.0	3.0	54.0	0.0
23	7.0	1.0	53.0	0.0
24	0.0	5.0	1.0	55.0
25	0.0	0.0	0.0	61.0
26	1.0	53.0	0.0	7.0
27	0.0	3.0	0.0	58.0
28	0.0	59.0	1.0	1.0
29	0.0	54.0	0.0	7.0
30	53.0	3.0	4.0	1.0
31	2.0	5.0	1.0	53.0

PFM

	A	C	G	T
01	0.0	0.885	0.0	0.115
02	0.0	0.082	0.016	0.902
03	0.066	0.0	0.016	0.918
04	0.0	0.902	0.0	0.098
05	0.066	0.131	0.016	0.787
06	0.016	0.0	0.984	0.0
07	0.0	1.0	0.0	0.0
08	0.902	0.0	0.0	0.098
09	0.0	1.0	0.0	0.0
10	0.0	0.0	0.0	1.0
11	0.18	0.0	0.82	0.0
12	0.0	0.984	0.0	0.016
13	0.0	1.0	0.0	0.0
14	0.0	0.918	0.0	0.082
15	0.0	0.0	0.0	1.0
16	1.0	0.0	0.0	0.0
17	0.0	0.0	1.0	0.0
18	0.0	0.984	0.0	0.016
19	0.951	0.049	0.0	0.0
20	0.049	0.0	0.869	0.082
21	0.918	0.016	0.0	0.066
22	0.066	0.049	0.885	0.0
23	0.115	0.016	0.869	0.0
24	0.0	0.082	0.016	0.902
25	0.0	0.0	0.0	1.0
26	0.016	0.869	0.0	0.115
27	0.0	0.049	0.0	0.951
28	0.0	0.967	0.016	0.016
29	0.0	0.885	0.0	0.115
30	0.869	0.049	0.066	0.016
31	0.033	0.082	0.016	0.869

PWM

	A	C	G	T
01	-2.762	1.218	-2.762	-0.707
02	-2.762	-0.993	-2.083	1.236
03	-1.175	-2.762	-2.083	1.254
04	-2.762	1.236	-2.762	-0.84
05	-1.175	-0.589	-2.083	1.103
06	-2.083	-2.762	1.322	-2.762
07	-2.762	1.338	-2.762	-2.762
08	1.236	-2.762	-2.762	-0.84
09	-2.762	1.338	-2.762	-2.762
10	-2.762	-2.762	-2.762	1.338
11	-0.303	-2.762	1.143	-2.762
12	-2.762	1.322	-2.762	-2.083
13	-2.762	1.338	-2.762	-2.762
14	-2.762	1.254	-2.762	-0.993
15	-2.762	-2.762	-2.762	1.338
16	1.338	-2.762	-2.762	-2.762
17	-2.762	-2.762	1.338	-2.762
18	-2.762	1.322	-2.762	-2.083
19	1.288	-1.397	-2.762	-2.762
20	-1.397	-2.762	1.2	-0.993
21	1.254	-2.083	-2.762	-1.175
22	-1.175	-1.397	1.218	-2.762
23	-0.707	-2.083	1.2	-2.762
24	-2.762	-0.993	-2.083	1.236
25	-2.762	-2.762	-2.762	1.338
26	-2.083	1.2	-2.762	-0.707
27	-2.762	-1.397	-2.762	1.288
28	-2.762	1.305	-2.083	-2.083
29	-2.762	1.218	-2.762	-0.707
30	1.2	-1.397	-1.175	-2.083
31	-1.682	-0.993	-2.083	1.2

Standard thresholds

P-value	Threshold
0.001	-12.45169
0.0005	-10.50464
0.0001	-6.29414