ZN443.H12CORE.0.P.C motif - HOmo sapiens COmprehensive MOdel COllection

Motif	ZN443.H12CORE.0.P.C
Gene (human)	ZNF443 (GeneCards)
Gene synonyms (human)
Gene (mouse)
Gene synonyms (mouse)
LOGO
LOGO (reverse complement)
Motif subtype	0
Quality	C

Motif length	23
Consensus	TAGCGGGTGTTTTTCCTTGACAC
GC content	47.62%
Information content (bits; total / per base)	39.397 / 1.713
Data sources	ChIP-Seq
Aligned words	84

ChIP-Seq benchmarking	Num. of experiments (peaksets)	auROC, median	auROC, best	auPRC, median	auPRC, best	pseudo-auROC, median	pseudo-auROC, best	pseudo-log-auROC, median	pseudo-log-auROC, best	Centrality, median	Centrality, best
Human	1 (2)	0.866	0.866	0.872	0.872	0.862	0.862	17.309	17.309	43.208	43.208

TF superclass	Zinc-coordinating DNA-binding domains {2} (TFClass)
TF class	C2H2 zinc finger factors {2.3} (TFClass)
TF family	More than 3 adjacent zinc fingers {2.3.3} (TFClass)
TF subfamily	ZNF442-like {2.3.3.74} (TFClass)
TFClass ID	TFClass: 2.3.3.74.5
HGNC	HGNC:20878
MGI
EntrezGene (human)	GeneID:10224 (SSTAR profile)
EntrezGene (mouse)
UniProt ID (human)	ZN443_HUMAN
UniProt ID (mouse)
UniProt AC (human)	Q9Y2A4 (TFClass)
UniProt AC (mouse)
GRECO-DB-TF	yes

ChIP-Seq	1 human, 0 mouse
HT-SELEX	0
Methyl-HT-SELEX	0

PCM	ZN443.H12CORE.0.P.C.pcm
PWM	ZN443.H12CORE.0.P.C.pwm
PFM	ZN443.H12CORE.0.P.C.pfm
Alignment	ZN443.H12CORE.0.P.C.words.tsv
Threshold to P-value map	ZN443.H12CORE.0.P.C.thr
Motif in other formats
JASPAR format	ZN443.H12CORE.0.P.C_jaspar_format.txt
MEME format	ZN443.H12CORE.0.P.C_meme_format.meme
Transfac format	ZN443.H12CORE.0.P.C_transfac_format.txt
Homer format	ZN443.H12CORE.0.P.C_homer_format_0.001.txt ZN443.H12CORE.0.P.C_homer_format_0.0005.txt ZN443.H12CORE.0.P.C_homer_format_0.0001.txt

PCM

	A	C	G	T
01	0.0	0.0	0.0	84.0
02	81.0	0.0	2.0	1.0
03	0.0	1.0	82.0	1.0
04	0.0	68.0	0.0	16.0
05	18.0	3.0	63.0	0.0
06	2.0	2.0	80.0	0.0
07	2.0	0.0	82.0	0.0
08	1.0	0.0	0.0	83.0
09	3.0	0.0	80.0	1.0
10	0.0	4.0	1.0	79.0
11	0.0	0.0	1.0	83.0
12	0.0	0.0	18.0	66.0
13	0.0	1.0	0.0	83.0
14	0.0	3.0	0.0	81.0
15	0.0	84.0	0.0	0.0
16	0.0	82.0	0.0	2.0
17	0.0	0.0	2.0	82.0
18	0.0	0.0	2.0	82.0
19	0.0	2.0	82.0	0.0
20	72.0	1.0	11.0	0.0
21	1.0	82.0	0.0	1.0
22	82.0	1.0	0.0	1.0
23	1.0	79.0	1.0	3.0

PFM

	A	C	G	T
01	0.0	0.0	0.0	1.0
02	0.964	0.0	0.024	0.012
03	0.0	0.012	0.976	0.012
04	0.0	0.81	0.0	0.19
05	0.214	0.036	0.75	0.0
06	0.024	0.024	0.952	0.0
07	0.024	0.0	0.976	0.0
08	0.012	0.0	0.0	0.988
09	0.036	0.0	0.952	0.012
10	0.0	0.048	0.012	0.94
11	0.0	0.0	0.012	0.988
12	0.0	0.0	0.214	0.786
13	0.0	0.012	0.0	0.988
14	0.0	0.036	0.0	0.964
15	0.0	1.0	0.0	0.0
16	0.0	0.976	0.0	0.024
17	0.0	0.0	0.024	0.976
18	0.0	0.0	0.024	0.976
19	0.0	0.024	0.976	0.0
20	0.857	0.012	0.131	0.0
21	0.012	0.976	0.0	0.012
22	0.976	0.012	0.0	0.012
23	0.012	0.94	0.012	0.036

PWM

	A	C	G	T
01	-2.994	-2.994	-2.994	1.348
02	1.312	-2.994	-1.962	-2.35
03	-2.994	-2.35	1.324	-2.35
04	-2.994	1.14	-2.994	-0.256
05	-0.146	-1.683	1.065	-2.994
06	-1.962	-1.962	1.3	-2.994
07	-1.962	-2.994	1.324	-2.994
08	-2.35	-2.994	-2.994	1.336
09	-1.683	-2.994	1.3	-2.35
10	-2.994	-1.465	-2.35	1.287
11	-2.994	-2.994	-2.35	1.336
12	-2.994	-2.994	-0.146	1.11
13	-2.994	-2.35	-2.994	1.336
14	-2.994	-1.683	-2.994	1.312
15	-2.994	1.348	-2.994	-2.994
16	-2.994	1.324	-2.994	-1.962
17	-2.994	-2.994	-1.962	1.324
18	-2.994	-2.994	-1.962	1.324
19	-2.994	-1.962	1.324	-2.994
20	1.196	-2.35	-0.602	-2.994
21	-2.35	1.324	-2.994	-2.35
22	1.324	-2.35	-2.994	-2.35
23	-2.35	1.287	-2.35	-1.683

Standard thresholds

P-value	Threshold
0.001	-8.12844
0.0005	-6.31079
0.0001	-2.39859