ZN254.H12CORE.0.P.C motif - HOmo sapiens COmprehensive MOdel COllection

Motif	ZN254.H12CORE.0.P.C
Gene (human)	ZNF254 (GeneCards)
Gene synonyms (human)	BMZF5, ZNF539, ZNF91L
Gene (mouse)
Gene synonyms (mouse)
LOGO
LOGO (reverse complement)
Motif subtype	0
Quality	C

Motif length	21
Consensus	AAGATGTAGGCTGGGAGGCTA
GC content	52.04%
Information content (bits; total / per base)	36.953 / 1.76
Data sources	ChIP-Seq
Aligned words	676

ChIP-Seq benchmarking	Num. of experiments (peaksets)	auROC, median	auROC, best	auPRC, median	auPRC, best	pseudo-auROC, median	pseudo-auROC, best	pseudo-log-auROC, median	pseudo-log-auROC, best	Centrality, median	Centrality, best
Human	1 (4)	0.962	0.98	0.959	0.976	0.944	0.968	16.857	17.639	561.219	583.886

TF superclass	Zinc-coordinating DNA-binding domains {2} (TFClass)
TF class	C2H2 zinc finger factors {2.3} (TFClass)
TF family	More than 3 adjacent zinc fingers {2.3.3} (TFClass)
TF subfamily	Unclassified {2.3.3.0} (TFClass)
TFClass ID	TFClass: 2.3.3.0.182
HGNC	HGNC:13047
MGI
EntrezGene (human)	GeneID:9534 (SSTAR profile)
EntrezGene (mouse)
UniProt ID (human)	ZN254_HUMAN
UniProt ID (mouse)
UniProt AC (human)	O75437 (TFClass)
UniProt AC (mouse)
GRECO-DB-TF	yes

ChIP-Seq	1 human, 0 mouse
HT-SELEX	0
Methyl-HT-SELEX	0

PCM	ZN254.H12CORE.0.P.C.pcm
PWM	ZN254.H12CORE.0.P.C.pwm
PFM	ZN254.H12CORE.0.P.C.pfm
Alignment	ZN254.H12CORE.0.P.C.words.tsv
Threshold to P-value map	ZN254.H12CORE.0.P.C.thr
Motif in other formats
JASPAR format	ZN254.H12CORE.0.P.C_jaspar_format.txt
MEME format	ZN254.H12CORE.0.P.C_meme_format.meme
Transfac format	ZN254.H12CORE.0.P.C_transfac_format.txt
Homer format	ZN254.H12CORE.0.P.C_homer_format_0.001.txt ZN254.H12CORE.0.P.C_homer_format_0.0005.txt ZN254.H12CORE.0.P.C_homer_format_0.0001.txt

PCM

	A	C	G	T
01	654.0	8.0	10.0	4.0
02	655.0	1.0	14.0	6.0
03	10.0	6.0	656.0	4.0
04	636.0	20.0	13.0	7.0
05	4.0	31.0	5.0	636.0
06	58.0	4.0	605.0	9.0
07	5.0	44.0	13.0	614.0
08	662.0	2.0	6.0	6.0
09	6.0	2.0	665.0	3.0
10	7.0	4.0	655.0	10.0
11	3.0	668.0	0.0	5.0
12	1.0	5.0	0.0	670.0
13	14.0	2.0	650.0	10.0
14	49.0	0.0	624.0	3.0
15	9.0	6.0	654.0	7.0
16	672.0	3.0	1.0	0.0
17	6.0	3.0	664.0	3.0
18	17.0	2.0	654.0	3.0
19	0.0	674.0	2.0	0.0
20	1.0	1.0	0.0	674.0
21	661.0	5.0	5.0	5.0

PFM

	A	C	G	T
01	0.967	0.012	0.015	0.006
02	0.969	0.001	0.021	0.009
03	0.015	0.009	0.97	0.006
04	0.941	0.03	0.019	0.01
05	0.006	0.046	0.007	0.941
06	0.086	0.006	0.895	0.013
07	0.007	0.065	0.019	0.908
08	0.979	0.003	0.009	0.009
09	0.009	0.003	0.984	0.004
10	0.01	0.006	0.969	0.015
11	0.004	0.988	0.0	0.007
12	0.001	0.007	0.0	0.991
13	0.021	0.003	0.962	0.015
14	0.072	0.0	0.923	0.004
15	0.013	0.009	0.967	0.01
16	0.994	0.004	0.001	0.0
17	0.009	0.004	0.982	0.004
18	0.025	0.003	0.967	0.004
19	0.0	0.997	0.003	0.0
20	0.001	0.001	0.0	0.997
21	0.978	0.007	0.007	0.007

PWM

	A	C	G	T
01	1.346	-2.875	-2.686	-3.412
02	1.348	-4.173	-2.39	-3.108
03	-2.686	-3.108	1.349	-3.412
04	1.318	-2.065	-2.456	-2.984
05	-3.412	-1.654	-3.248	1.318
06	-1.051	-3.412	1.268	-2.776
07	-3.248	-1.319	-2.456	1.283
08	1.358	-3.851	-3.108	-3.108
09	-3.108	-3.851	1.363	-3.607
10	-2.984	-3.412	1.348	-2.686
11	-3.607	1.367	-4.651	-3.248
12	-4.173	-3.248	-4.651	1.37
13	-2.39	-3.851	1.34	-2.686
14	-1.215	-4.651	1.299	-3.607
15	-2.776	-3.108	1.346	-2.984
16	1.373	-3.607	-4.173	-4.651
17	-3.108	-3.607	1.361	-3.607
18	-2.215	-3.851	1.346	-3.607
19	-4.651	1.376	-3.851	-4.651
20	-4.173	-4.173	-4.651	1.376
21	1.357	-3.248	-3.248	-3.248

Standard thresholds

P-value	Threshold
0.001	-12.96549
0.0005	-10.84719
0.0001	-6.28349