Z585B.H12INVITRO.0.P.D motif - HOmo sapiens COmprehensive MOdel COllection

Motif	Z585B.H12INVITRO.0.P.D
Gene (human)	ZNF585B (GeneCards)
Gene synonyms (human)
Gene (mouse)
Gene synonyms (mouse)
LOGO
LOGO (reverse complement)
Motif subtype	0
Quality	D

Motif length	24
Consensus	GAGGCCTAGGAGGAAAAAATGGTT
GC content	47.8%
Information content (bits; total / per base)	37.417 / 1.559
Data sources	ChIP-Seq
Aligned words	1000

ChIP-Seq benchmarking	Num. of experiments (peaksets)	auROC, median	auROC, best	auPRC, median	auPRC, best	pseudo-auROC, median	pseudo-auROC, best	pseudo-log-auROC, median	pseudo-log-auROC, best	Centrality, median	Centrality, best
Human	1 (7)	0.992	0.996	0.991	0.995	0.99	0.995	19.489	19.977	863.347	914.745

TF superclass	Zinc-coordinating DNA-binding domains {2} (TFClass)
TF class	C2H2 zinc finger factors {2.3} (TFClass)
TF family	More than 3 adjacent zinc fingers {2.3.3} (TFClass)
TF subfamily	ZNF81-like {2.3.3.68} (TFClass)
TFClass ID	TFClass: 2.3.3.68.5
HGNC	HGNC:30948
MGI
EntrezGene (human)	GeneID:92285 (SSTAR profile)
EntrezGene (mouse)
UniProt ID (human)	Z585B_HUMAN
UniProt ID (mouse)
UniProt AC (human)	Q52M93 (TFClass)
UniProt AC (mouse)
GRECO-DB-TF	yes

ChIP-Seq	1 human, 0 mouse
HT-SELEX	0
Methyl-HT-SELEX	0

PCM	Z585B.H12INVITRO.0.P.D.pcm
PWM	Z585B.H12INVITRO.0.P.D.pwm
PFM	Z585B.H12INVITRO.0.P.D.pfm
Alignment	Z585B.H12INVITRO.0.P.D.words.tsv
Threshold to P-value map	Z585B.H12INVITRO.0.P.D.thr
Motif in other formats
JASPAR format	Z585B.H12INVITRO.0.P.D_jaspar_format.txt
MEME format	Z585B.H12INVITRO.0.P.D_meme_format.meme
Transfac format	Z585B.H12INVITRO.0.P.D_transfac_format.txt
Homer format	Z585B.H12INVITRO.0.P.D_homer_format_0.001.txt Z585B.H12INVITRO.0.P.D_homer_format_0.0005.txt Z585B.H12INVITRO.0.P.D_homer_format_0.0001.txt

PCM

	A	C	G	T
01	34.0	13.0	946.0	7.0
02	960.0	8.0	23.0	9.0
03	21.0	2.0	970.0	7.0
04	21.0	7.0	963.0	9.0
05	20.0	854.0	16.0	110.0
06	18.0	867.0	13.0	102.0
07	17.0	131.0	22.0	830.0
08	953.0	6.0	36.0	5.0
09	43.0	0.0	956.0	1.0
10	25.0	1.0	969.0	5.0
11	973.0	5.0	17.0	5.0
12	25.0	0.0	967.0	8.0
13	27.0	2.0	961.0	10.0
14	739.0	20.0	236.0	5.0
15	850.0	111.0	14.0	25.0
16	931.0	13.0	14.0	42.0
17	818.0	10.0	155.0	17.0
18	995.0	3.0	2.0	0.0
19	858.0	3.0	126.0	13.0
20	7.0	29.0	11.0	953.0
21	13.0	1.0	982.0	4.0
22	48.0	14.0	897.0	41.0
23	6.0	29.0	15.0	950.0
24	19.0	15.0	18.0	948.0

PFM

	A	C	G	T
01	0.034	0.013	0.946	0.007
02	0.96	0.008	0.023	0.009
03	0.021	0.002	0.97	0.007
04	0.021	0.007	0.963	0.009
05	0.02	0.854	0.016	0.11
06	0.018	0.867	0.013	0.102
07	0.017	0.131	0.022	0.83
08	0.953	0.006	0.036	0.005
09	0.043	0.0	0.956	0.001
10	0.025	0.001	0.969	0.005
11	0.973	0.005	0.017	0.005
12	0.025	0.0	0.967	0.008
13	0.027	0.002	0.961	0.01
14	0.739	0.02	0.236	0.005
15	0.85	0.111	0.014	0.025
16	0.931	0.013	0.014	0.042
17	0.818	0.01	0.155	0.017
18	0.995	0.003	0.002	0.0
19	0.858	0.003	0.126	0.013
20	0.007	0.029	0.011	0.953
21	0.013	0.001	0.982	0.004
22	0.048	0.014	0.897	0.041
23	0.006	0.029	0.015	0.95
24	0.019	0.015	0.018	0.948

PWM

	A	C	G	T
01	-1.952	-2.839	1.326	-3.362
02	1.34	-3.253	-2.32	-3.156
03	-2.405	-4.213	1.351	-3.362
04	-2.405	-3.362	1.344	-3.156
05	-2.45	1.224	-2.653	-0.812
06	-2.546	1.239	-2.839	-0.887
07	-2.598	-0.64	-2.362	1.195
08	1.333	-3.484	-1.898	-3.622
09	-1.728	-4.982	1.336	-4.525
10	-2.243	-4.525	1.35	-3.622
11	1.354	-3.622	-2.598	-3.622
12	-2.243	-4.982	1.348	-3.253
13	-2.171	-4.213	1.341	-3.066
14	1.079	-2.45	-0.057	-3.622
15	1.219	-0.803	-2.773	-2.243
16	1.31	-2.839	-2.773	-1.75
17	1.181	-3.066	-0.474	-2.598
18	1.376	-3.975	-4.213	-4.982
19	1.228	-3.975	-0.678	-2.839
20	-3.362	-2.103	-2.985	1.333
21	-2.839	-4.525	1.363	-3.783
22	-1.622	-2.773	1.273	-1.774
23	-3.484	-2.103	-2.711	1.33
24	-2.497	-2.711	-2.546	1.328

Standard thresholds

P-value	Threshold
0.001	-11.73069
0.0005	-9.69444
0.0001	-5.31029